You are leaving Medscape Education
Cancel Continue
Log in to save activities Your saved activities will show here so that you can easily access them whenever you're ready. Log in here CME & Education Log in to keep track of your credits.
 

Table 2.  

Hugo_Symbol Variant_Classification RegID LGL_Type

ABCC9

Missense_Mutation

1844

T

ABCC9

Missense_Mutation

2108

T

ABCC9

Missense_Mutation

2022

T

ABCC9

Missense_Mutation

2062

T

ABCC9

Nonsense_Mutation

2127

T

ADAMTSL1

Missense_Mutation

2119

T

ADAMTSL1

Missense_Mutation

2207

T

ADAMTSL1

Missense_Mutation

2081

T

ADAMTSL1

Splice_Region

2051

T

ARHGAP25

Missense_Mutation

2103

T

ARHGAP25

Frame_Shift_Del

2103

T

ARHGAP25

Frame_Shift_Del

2049

T

ARHGAP25

Frame_Shift_Ins

2157

GD

ARNT2

Missense_Mutation

2135

T

ARNT2

Missense_Mutation

1888

GD

ARNT2

Missense_Mutation

2127

T

ASXL3

Missense_Mutation

2214

T

ASXL3

Missense_Mutation

2074

T

ASXL3

Missense_Mutation

2090

GD

C2orf71

Missense_Mutation

2217

T

C2orf71

Missense_Mutation

2107

T

C2orf71

Missense_Mutation

2214

T

CACNA1E

Missense_Mutation

1499

T

CACNA1E

Missense_Mutation

2190

T

CACNA1E

Missense_Mutation

2022

T

CACNA2D3

Missense_Mutation

1844

T

CACNA2D3

Missense_Mutation

2225

T

CACNA2D3

Missense_Mutation

1822

GD

CAD

Missense_Mutation

1918

T

CAD

Missense_Mutation

2074

T

CAD

Splice_Region

2090

GD

CDH20

Missense_Mutation

1544

T

CDH20

Missense_Mutation

2200

T

CDH20

Missense_Mutation

1796

T

CHD9

Splice_Region

2200

T

CHD9

Missense_Mutation

2098

T

CHD9

Nonsense_Mutation

2062

T

CHD9

Missense_Mutation

2127

T

CNTNAP2

Missense_Mutation

2084

T

CNTNAP2

Splice_Region

1955

T

CNTNAP2

Missense_Mutation

2127

T

COL11A1

Splice_Site

2205

T

COL11A1

Missense_Mutation

2205

T

COL11A1

Splice_Region

2169

T

COL11A1

Missense_Mutation

2037

T

COL11A1

Missense_Mutation

2146

T

COL11A1

Splice_Region

2127

T

COL24A1

Nonsense_Mutation

2049

T

COL24A1

Missense_Mutation

1718

T

COL24A1

Splice_Region

2051

T

COL3A1

Splice_Region

2042

T

COL3A1

Nonsense_Mutation

2191

T

COL3A1

Missense_Mutation

1798

T

CSMD3

Nonsense_Mutation

2205

T

CSMD3

Missense_Mutation

2049

T

CSMD3

Missense_Mutation

2214

T

CUX2

Splice_Region

2249

T

CUX2

Missense_Mutation

1974

T

CUX2

Missense_Mutation

2051

T

DAPK1

Missense_Mutation

2095

T

DAPK1

Missense_Mutation

2042

T

DAPK1

Missense_Mutation

2082

T

DDX59

Missense_Mutation

2108

T

DDX59

Missense_Mutation

2049

T

DDX59

Missense_Mutation

2084

T

DDX59

Missense_Mutation

2084

T

DMD

Missense_Mutation

2249

T

DMD

Splice_Region

2204

T

DMD

Missense_Mutation

2042

T

DMD

Missense_Mutation

1999

T

DNAH5

Missense_Mutation

1822

GD

DNAH5

Missense_Mutation

2157

GD

DNAH5

Missense_Mutation

2127

T

DNER

Missense_Mutation

1715

T

DNER

Splice_Region

2081

T

DNER

Splice_Site

2062

T

DNMT3A

Missense_Mutation

2226

T

DNMT3A

Missense_Mutation

2135

T

DNMT3A

Missense_Mutation

1549

T

DSCAM

Missense_Mutation

2214

T

DSCAM

Missense_Mutation

2186

GD

DSCAM

Missense_Mutation

2146

T

EPHA7

Splice_Region

1746

T

EPHA7

Missense_Mutation

1970

T

EPHA7

Missense_Mutation

2051

T

EYS

Missense_Mutation

2214

T

EYS

Missense_Mutation

2105

T

EYS

Missense_Mutation

1906

T

EYS

Missense_Mutation

2090

GD

FAS

Nonsense_Mutation

2249

T

FAS

Frame_Shift_Del

2056

T

FAS

Splice_Region

2077

T

FAS

Missense_Mutation

2077

T

FAT3

Missense_Mutation

2042

T

FAT3

Missense_Mutation

2084

T

FAT3

Missense_Mutation

2169

T

FAT3

Missense_Mutation

2062

T

FAT4

Missense_Mutation

1918

T

FAT4

Missense_Mutation

2228

T

FAT4

Missense_Mutation

1688

T

FAT4

Missense_Mutation

1798

T

FSIP2

Missense_Mutation

2202

T

FSIP2

Missense_Mutation

2251

T

FSIP2

Missense_Mutation

2074

T

FSTL5

Missense_Mutation

1945

T

FSTL5

Missense_Mutation

2009

T

FSTL5

Missense_Mutation

2225

T

GLI3

Missense_Mutation

1718

T

GLI3

Missense_Mutation

2051

T

GLI3

Nonsense_Mutation

2127

T

GRID2

Splice_Region

2164

T

GRID2

Missense_Mutation

1822

GD

GRID2

Missense_Mutation

2127

T

HERC2

Nonsense_Mutation

2249

T

HERC2

Missense_Mutation

2042

T

HERC2

Frame_Shift_Del

2146

T

HRNR

Missense_Mutation

2174

T

HRNR

Missense_Mutation

2037

T

HRNR

Missense_Mutation

2146

T

HTT

Missense_Mutation

2107

T

HTT

In_Frame_Del

2165

T

HTT

Missense_Mutation

1960

GD

ITGAL

Missense_Mutation

1844

T

ITGAL

Splice_Region

2042

T

ITGAL

Missense_Mutation

2152

T

ITGAL

Splice_Region

1549

T

KDM6A

Nonsense_Mutation

2173

T

KDM6A

Missense_Mutation

1544

T

KDM6A

Splice_Region

2214

T

KDM6A

Frame_Shift_Del

1798

T

KIAA0196

Missense_Mutation

2083

GD

KIAA0196

Missense_Mutation

1822

GD

KIAA0196

Missense_Mutation

1549

T

KMT2D

Nonsense_Mutation

2249

T

KMT2D

Frame_Shift_Del

2207

T

KMT2D

Nonsense_Mutation

2207

T

KMT2D

Frame_Shift_Del

2225

T

KMT2D

In_Frame_Del

2029

T

KMT2D

Nonsense_Mutation

2042

T

KMT2D

Frame_Shift_Del

2105

T

KMT2D

Nonsense_Mutation

2147

T

KMT2D

Nonsense_Mutation

2074

T

KMT2D

Frame_Shift_Ins

2090

GD

KMT2D

Missense_Mutation

2051

T

KMT2D

Splice_Site

2127

T

KY

Missense_Mutation

1844

T

KY

Nonsense_Mutation

1895

T

KY

Splice_Region

2157

GD

LAMC3

Missense_Mutation

2135

T

LAMC3

Missense_Mutation

1822

GD

LAMC3

Splice_Region

1974

T

MUC16

Missense_Mutation

2205

T

MUC16

Missense_Mutation

2107

T

MUC16

Missense_Mutation

2103

T

MUC16

Missense_Mutation

1955

T

MYO18B

Missense_Mutation

1499

T

MYO18B

Missense_Mutation

2042

T

MYO18B

Missense_Mutation

2074

T

MYO18B

Missense_Mutation

2127

T

NCKAP5

Missense_Mutation

1544

T

NCKAP5

Missense_Mutation

2249

T

NCKAP5

Missense_Mutation

1549

T

NCKAP5

Missense_Mutation

2144

T

NDST3

Missense_Mutation

2103

T

NDST3

Missense_Mutation

1746

T

NDST3

Missense_Mutation

1822

GD

NRP2

Missense_Mutation

1544

T

NRP2

Missense_Mutation

2107

T

NRP2

Splice_Site

2049

T

OLFML2A

Missense_Mutation

2135

T

OLFML2A

Missense_Mutation

2180

T

OLFML2A

Missense_Mutation

2157

GD

OTOG

Missense_Mutation

2208

GD

OTOG

Missense_Mutation

2207

T

OTOG

Missense_Mutation

1746

T

PCDH11X

Missense_Mutation

2205

T

PCDH11X

Missense_Mutation

2228

T

PCDH11X

Missense_Mutation

1970

T

PCDH15

Missense_Mutation

1970

T

PCDH15

Missense_Mutation

2191

T

PCDH15

Missense_Mutation

2074

T

PCDHA11

Missense_Mutation

1544

T

PCDHA11

Missense_Mutation

1888

GD

PCDHA11

Missense_Mutation

2042

T

PCLO

Missense_Mutation

1844

T

PCLO

Missense_Mutation

1746

T

PCLO

Missense_Mutation

2152

T

PCLO

Missense_Mutation

2051

T

PIK3R1

In_Frame_Del

2249

T

PIK3R1

Missense_Mutation

1746

T

PIK3R1

Missense_Mutation

2247

GD

PIK3R1

Missense_Mutation

2143

T

RYR2

Missense_Mutation

2173

T

RYR2

Missense_Mutation

1945

T

RYR2

Missense_Mutation

1544

T

RYR2

Missense_Mutation

2251

T

RYR2

Nonsense_Mutation

1895

T

RYR2

Missense_Mutation

2074

T

SALL3

Missense_Mutation

2165

T

SALL3

Missense_Mutation

1549

T

SALL3

Missense_Mutation

2127

T

SETD1B

Splice_Site

1544

T

SETD1B

In_Frame_Del

2228

T

SETD1B

Missense_Mutation

2214

T

SETD1B

Splice_Site

2074

T

SETD1B

Splice_Site

1974

T

SETD1B

Frame_Shift_Del

2127

T

SLC6A15

Missense_Mutation

1918

T

SLC6A15

Missense_Mutation

2074

T

SLC6A15

Missense_Mutation

1999

T

SLC6A15

Missense_Mutation

2051

T

SMAD6

In_Frame_Del

2174

T

SMAD6

Frame_Shift_Del

2174

T

SMAD6

Nonsense_Mutation

2126

T

SMAD6

Missense_Mutation

1955

T

SORCS3

Splice_Site

1499

T

SORCS3

Missense_Mutation

1746

T

SORCS3

Missense_Mutation

2042

T

SRRM2

Missense_Mutation

2228

T

SRRM2

Missense_Mutation

1822

GD

SRRM2

Missense_Mutation

2090

GD

SSC5D

Missense_Mutation

1948

T

SSC5D

Missense_Mutation

1822

GD

SSC5D

Missense_Mutation

1974

T

STAT3

Missense_Mutation

1715

T

STAT3

Missense_Mutation

1499

T

STAT3

Missense_Mutation

1474

T

STAT3

Missense_Mutation

1918

T

STAT3

Missense_Mutation

2020

T

STAT3

Missense_Mutation

1544

T

STAT3

Missense_Mutation

2205

T

STAT3

Missense_Mutation

1849

T

STAT3

Missense_Mutation

2208

GD

STAT3

Missense_Mutation

2249

T

STAT3

Missense_Mutation

2056

T

STAT3

Missense_Mutation

2228

T

STAT3

Missense_Mutation

2108

T

STAT3

Missense_Mutation

2103

T

STAT3

Missense_Mutation

2207

T

STAT3

Missense_Mutation

2207

T

STAT3

Missense_Mutation

2049

T

STAT3

Missense_Mutation

2139

T

STAT3

Missense_Mutation

2139

T

STAT3

Missense_Mutation

1746

T

STAT3

Missense_Mutation

1970

T

STAT3

Missense_Mutation

2180

T

STAT3

Missense_Mutation

1796

T

STAT3

Missense_Mutation

1718

T

STAT3

Missense_Mutation

2151

T

STAT3

Missense_Mutation

2225

T

STAT3

Missense_Mutation

2174

T

STAT3

Missense_Mutation

1888

GD

STAT3

Missense_Mutation

2095

T

STAT3

Missense_Mutation

2126

T

STAT3

Missense_Mutation

2214

T

STAT3

Missense_Mutation

2042

T

STAT3

Missense_Mutation

2110

T

STAT3

Missense_Mutation

2084

T

STAT3

Missense_Mutation

2105

T

STAT3

Missense_Mutation

2251

T

STAT3

Missense_Mutation

2147

T

STAT3

Missense_Mutation

1985

T

STAT3

Missense_Mutation

2190

T

STAT3

Missense_Mutation

2152

T

STAT3

Missense_Mutation

2152

T

STAT3

Missense_Mutation

2082

T

STAT3

Missense_Mutation

2164

T

STAT3

Missense_Mutation

2022

T

STAT3

Missense_Mutation

1798

T

STAT3

Missense_Mutation

2074

T

STAT3

Missense_Mutation

2090

GD

STAT3

Missense_Mutation

2081

T

STAT3

Missense_Mutation

2062

T

STAT3

Missense_Mutation

2037

T

STAT3

Missense_Mutation

1974

T

STAT3

Missense_Mutation

2144

T

STAT3

Missense_Mutation

2051

T

STAT3

Missense_Mutation

2157

GD

STAT3

Missense_Mutation

2157

GD

STAT3

Missense_Mutation

2077

T

STAT3

Missense_Mutation

2127

T

STAT5B

Missense_Mutation

1844

T

STAT5B

Missense_Mutation

1895

T

STAT5B

Missense_Mutation

1822

GD

SULF1

Missense_Mutation

1844

T

SULF1

Missense_Mutation

2009

T

SULF1

Missense_Mutation

2049

T

SULF1

Missense_Mutation

1822

GD

SVEP1

Missense_Mutation

1888

GD

SVEP1

Missense_Mutation

2074

T

SVEP1

Missense_Mutation

2051

T

SYNJ1

Missense_Mutation

2029

T

SYNJ1

Missense_Mutation

2110

T

SYNJ1

Missense_Mutation

2105

T

TENM3

Splice_Site

1499

T

TENM3

Missense_Mutation

1544

T

TENM3

Missense_Mutation

1746

T

TENM3

Missense_Mutation

2191

T

TET2

Frame_Shift_Del

2228

T

TET2

Frame_Shift_Del

2207

T

TET2

Frame_Shift_Del

2049

T

TET2

Nonsense_Mutation

2126

T

TET2

Nonsense_Mutation

2251

T

TNFAIP3

Nonsense_Mutation

1544

T

TNFAIP3

Frame_Shift_Del

2249

T

TNFAIP3

Missense_Mutation

2249

T

TNFAIP3

Nonsense_Mutation

2139

T

TNFAIP3

Frame_Shift_Ins

2145

T

TNFAIP3

Frame_Shift_Del

2145

T

TNFAIP3

Nonsense_Mutation

2125

T

TNFAIP3

Frame_Shift_Del

2082

T

TNFAIP3

Frame_Shift_Ins

2074

T

TNFAIP3

Missense_Mutation

2081

T

TNFAIP3

Frame_Shift_Del

2037

T

TTN

Missense_Mutation

2205

T

TTN

Missense_Mutation

2153

T

TTN

Missense_Mutation

2110

T

TTN

Missense_Mutation

2251

T

TTN

Missense_Mutation

2190

T

TTN

Missense_Mutation

1960

GD

TTN

Missense_Mutation

2081

T

USH2A

Missense_Mutation

2173

T

USH2A

Missense_Mutation

2205

T

USH2A

Missense_Mutation

2122

T

USH2A

Missense_Mutation

2207

T

USH2A

Missense_Mutation

2225

T

USH2A

Missense_Mutation

2125

T

USH2A

Splice_Region

2152

T

VCAN

Missense_Mutation

1844

T

VCAN

Missense_Mutation

2214

T

VCAN

Missense_Mutation

2125

T

VCAN

Missense_Mutation

2077

T

WDFY3

Nonsense_Mutation

2139

T

WDFY3

Missense_Mutation

2147

T

WDFY3

Splice_Region

1549

T

XIRP2

Missense_Mutation

2202

T

XIRP2

Missense_Mutation

2084

T

XIRP2

Missense_Mutation

2105

T

ZNF585B

Missense_Mutation

2174

T

ZNF585B

Missense_Mutation

2214

T

ZNF585B

Missense_Mutation

2022

T

Supplemental Table 2.

Genes that are mutated in three or more patients in the cohort are shown.

Table 3.  

Oligonucleotide primer list
PCR Target RefSeq Accession No. Detected Coding Transcript(s) BioRad Unique Assay ID Amplicon Context Sequence

ZBTB46

NC_000020.10, NT_011333.6

ENST00000245663, ENST00000302995, ENST00000395104

qHsaCID0021250

CAGTACGGACACTTGAACTTCTTCCTGATCACCGTGAACTCATTCAGGGACAGCGAGTGGGCCCCTCTGGGCAGGTACTCGAACAGCAGGGAGCCGTCATCCCCCAGCACGT

AKT3

NG_027811.1, NC_000001.10, NT_167186.1

ENST00000336199, ENST00000366540, ENST00000366539, ENST00000552631,

qHsaCID0036448

TTATCAATTTGTGAAGTTGGACTACAATTCATTCTCTCCTCTTCTTGCCTCTGCAGTCTGTCTGCTACAGCCTGGATAGCTTCTGTCCATTCTTCCCTTTCCTCTGGAGTATCTACATGAAATGTTC

PDGFB

NC_000022.10, NG_012111.1, NT_011520.12

ENST00000263826

qHsaCID0016004

AGCTCGCCTCCAGAGTGGGAGCGGGTCATGTTCAGGTCCAACTCGGCCCCATCTTCCTCTCCGGGGTCTCCGTGCAGCAGGCGTTGGAGATCATCAAAGGAGCGGATCGAGTGGTC

STAT3

NC_000017.10, NT_010783.15, NG_007370.1

ENST00000264657, ENST00000404395, ENST00000389272

qHsaCID0010912

GGTGTCACACAGATAAACTTGGTCTTCAGGTATGGGGCAGCGCTACCTGGGTCAGCTTCAGGATGCTCCTGGCTCTCTGGCCGACAATACTTTCCGAATGCCTCCTCCTTGGGAATGTCAGGATAGAGATAGACCAGTGGAGACACCAGGATATTGGT

STAT1

NC_000002.11, NG_008294.1, NT_005403.17

ENST00000361099, ENST00000409465, ENST00000392322, ENST00000392323,

qHsaCID0007580

TTGTCTAACATCACTGTGCTCTGAATATTCCCCGACTGAGCCTGATTAAATCTCTGGGCGTTTTCCAGAATTTTCCTTTCTTCCTTCAGACAGCTGTAAATGATCATAGACATCTGGATTGG

PDGFRβ

NC_000005.9, NG_012303.1, NG_023367.1, NT_029289.11

ENST00000261799, ENST00000544453

qHsaCID0013272

TGGTAGCTGAAGCCCACGAGGTCCATGTAGCTTAGCACTGGAGACTCGTTGATCAAAGTTGCTCGGCAGGTCCTCTCAGGGGCAGAGGGAACGTAGTTATCGTAAGGGGCCATGTAGTTGGAGGACTCGATGTCTGCATATTTGACG

HPRT1

NC_000023.10, NG_012329.1, NT_011786.16

ENST00000298556, ENST00000370796

qHsaCID0016375

GACACTGGCAAAACAATGCAGACTTTGCTTTCCTTGGTCAGGCAGTATAATCCAAAGATGGTCAAGGTCGCAAGCTTGCTGGTGAAAAGGACCCCACGAAGTGTTGGATATAAGCCAGAC

TBP

NC_000006.11, NT_025741.15, NG_008165.1

ENST00000230354, ENST00000392092, ENST00000392091, ENST00000540980

qHsaCID0007122

AAATATTGTATCCACAGTGAATCTTGGTTGTAAACTTGACCTAAAGACCATTGCACTTCGTGCCCGAAACGCCGAATATAATCCCAAGCGGTTTGCTGCGGTAATCATGAGGATAAGAGAGCCACGAACCACGGCACTGATTTTCAGTTC

Supplemental Table 3.

Table 5.  

RegID LGL type cellularity_percent lymphocyte_percent CD3 CD8 M_E_ratio Reticulin TCR_clone TIA_staining Granzyme TET2 STAT3 TNFAIP3 KMT2D SETD1B

1715

T

NA

NA

Y

Y

NA

NA

Y

NA

NA

N

Y

N

N

N

1718

T

60

15

Y

Y

3

Zero

Y

Y

Y

N

Y

N

N

N

1849

T

65

10

Y

Y

3

Zero

Y

N

N

N

Y

N

N

N

1918

T

60

24

Y

Y

4

Zero

Y

Y

Y

N

Y

N

N

N

1948

T

30

14

Y

N

0.5

Zero

Y

NA

NA

N

N

N

N

N

1955

T

55

17

Y

Y

3

Zero

Y

NA

N

N

N

N

N

N

1960

GD

75

48

Y

Y

3

One

N

N

Y

N

N

N

N

N

1970

T

85

59

Y

Y

5

Three

Y

NA

N

N

Y

N

N

N

1973

T

60

30

Y

Y

2

Two

Y

NA

N

N

N

N

N

N

2042

T

NA

NA

Y

Y

1

NA

NA

NA

NA

N

Y

N

Y

N

2050

T

30

21

Y

Y

3

Zero

NA

NA

NA

N

N

N

N

N

2056

T

55

19

Y

Y

3

NA

Y

NA

NA

N

Y

N

N

N

2062

T

50

26

Y

Y

3

Two

Y

Y

Y

N

Y

N

N

N

2074

T

30

20

Y

Y

3

NA

Y

Y

Y

N

Y

Y

Y

Y

2080

GD

10

15

Y

Y

3

Two

Y

Y

Y

N

N

N

N

N

2083

GD

5

NA

Y

Y

3

One

Y

NA

NA

N

N

N

N

N

2084

T

80

40

Y

Y

0.4

One

N

N

N

N

Y

N

N

N

2108

T

45

NA

Y

Y

3

One

Y

Y

Y

N

Y

N

N

N

2110

T

25

34

Y

Y

0.2

Zero

Y

Y

Y

N

Y

N

N

N

2116

GD

12

39

Y

Y

3

Zero

N

N

N

N

N

N

N

N

2119

T

40

25

Y

Y

3

Zero

N

N

N

N

N

N

N

N

2122

T

30

NA

Y

Y

3

Zero

N

N

N

N

N

N

N

N

2126

T

50

42

NA

NA

4

One

Y

NA

NA

Y

Y

N

N

N

2151

T

45

33

Y

Y

3

One

N

N

N

N

Y

N

N

N

2152

T

60

25

Y

Y

NA

NA

N

N

N

N

Y

N

N

N

2169

T

45

6

Y

NA

3

One

NA

NA

NA

N

N

N

N

N

2208

GD

30

13

Y

Y

3

Zero

N

N

N

N

Y

N

N

N

2228

T

70

3

Y

Y

3

Zero

NA

NA

NA

Y

Y

N

N

Y

2247

GD

34

1

Y

NA

0.2

Zero

Y

Y

Y

N

N

N

N

N

1474

T

65

25

Y

Y

3

Zero

Y

NA

NA

N

Y

N

N

N

1499

T

70

NA

Y

Y

2

NA

Y

Y

N

N

Y

N

N

N

1544

T

40

18

Y

Y

1.4

Zero

NA

NA

NA

N

Y

Y

N

Y

1549

T

90

20

Y

Y

6

Two

Y

NA

NA

N

N

N

N

N

1726

T

80

NA

Y

Y

1

NA

Y

NA

NA

N

N

N

N

N

1733

T

45

NA

Y

Y

0.8

Zero

Y

Y

Y

N

N

N

N

N

1746

T

60

NA

Y

Y

2

One

Y

NA

NA

N

Y

N

N

N

1798

T

45

5

Y

Y

NA

One

Y

NA

NA

N

Y

N

N

N

1822

T

70

17

Y

Y

NA

NA

NA

NA

NA

N

N

N

N

N

1945

T

65

40

Y

Y

3

Zero

Y

Y

Y

N

N

N

N

N

1985

T

15

15

Y

Y

1.4

Zero

NA

NA

NA

N

Y

N

N

N

2107

T

15

NA

Y

NA

NA

NA

NA

NA

NA

N

N

N

N

N

2214

T

55

22

Y

Y

2

Zero

Y

Y

Y

N

Y

N

N

Y

Supplemental Table 5.

RegID: Patient registry ID at UVA LGL registry
Cellularity_percent: Percent of bone marrow biopsy specimen composing the volume of cells compared to the volume of other components of the bone marrow, acquired from pathology report of bone marrow biopsy
lymphocyte_percent: Percent of lymphocytes acquired from pathology report of bone marrow aspirate
CD3: Presence or absence of CD3+ lymphocytes in bone marrow aspirate
CD8: Presence or absence of CD8+ lymphocytes in bone marrow aspirate
M_E_ratio: The ratio of myeloid to erythroid precursors acquired from the pathology report of bone marrow biopsy
Reticulin: Reticulin staining of bone marrow biopsy graded on bauermeister scale as follows: 0 (absent), 1 (fine fibers), 2 (diffuse fine fiber network), 3 (diffuse fiber network with scattered coarse fibers), and 4 (areas of collagen on trichrome stain)
TCR_clone: Presence of absence of T-cell receptor clone via gamma-chain gene PCR assay
TIA_staining: Presence or absence of TIA-1 antibodies acquired from immunohistochemistry report of bone marrow biopsy specimens
Granzyme: Presence or absence of granzyme B antibodies acquired from immunohistochemistry report of bone marrow biopsy specimens
TET2 to SETD1B: Presence of somatic mutations (as indicated in the column name) in patient whole exome sequencing data. These five genes are selected based on frequency of occurrence in the cohort as a putative driver, and it's co-occurrence with STAT3 mutations.
NA values: Not available

Table 6.  

RegID Age (Years) Sex LGL_Type RBC (10e6/mm3) HCT (%) HGB (g/dL) WBC (10e9/L) MCV (fL) RDW (%) Platelets (10e9/L) >Neutrophils (%) Lymphocytes (%) ANC (k/µL) ALC (k/µL) Rheumatoid Arthritis (Y/N) Treatment_at_sequencing Treatment Treatment Response LGL absolute count (k/µL TCRgdpos (%) TCRgdposCD3pos (%) CD3pos (%) CD8pos (%) CD3posCD8pos (%) CD16pos (%) CD3posCD16pos (%) CD56pos (%) CD3posCD56pos (%) CD57pos (%) CD3posCD57pos (%) CD3negCD16pos (%) CD3negCD56pos (%) CD3negCD57pos (%) CD94pos (%)

1474

72

M

T

4.37

40.1

13.4

6.1

91.8

14.9

166

28

65

1.71

3.97

N

N

   

190.56

NA

NA

NA

NA

75

NA

6

NA

6

NA

48

NA

NA

NA

NA

1499

50

F

T

4.64

38.7

13.6

2.9

83.4

13.7

145

4

86

0.12

2.49

N

Y

Cyclosporine

NR

9.96

NA

NA

NA

NA

53

NA

3

NA

4

NA

4

NA

NA

NA

NA

1544

54

F

T

4.35

38

12.9

4.6

87.4

14.7

290

13

76

0.6

3.5

N

N

     

NA

NA

93

76

NA

60

NA

2

NA

34

NA

NA

NA

NA

NA

1549

70

F

T

2.7

31.8

10

2.7

117.8

13.8

166

25

67

0.68

1.81

N

NA

   

137.56

NA

NA

95

86

84

NA

76

NA

1

NA

66

NA

NA

NA

NA

1688

59

F

T

3.95

38.7

12.6

2.5

98

12.9

150

56.1

37.5

1.4

0.94

N

N

     

NA

NA

NA

50

NA

NA

NA

NA

17

NA

NA

NA

NA

NA

NA

1715

44

F

T

2.74

28.4

9.9

7.7

103.6

16.5

327

5

90

0.39

6.93

N

N

     

NA

NA

76

NA

46

30

NA

NA

NA

50

NA

NA

NA

NA

NA

1718

59

M

T

3.19

30.8

10.4

6.58

96.6

15.9

281

15.6

76.1

1.03

5.01

N

N

   

275.55

NA

NA

NA

NA

75

NA

3

NA

2

NA

55

NA

NA

NA

NA

1726

76

M

GD

4.44

40

14.1

6.32

90.1

13.5

82

80.5

9.2

5.09

0.58

N

Y

Cytoxan

NE

2.9

85

NA

96

NA

15

NA

0

NA

22

NA

5

NA

NA

NA

NA

1733

64

F

T

3.66

34.9

11.3

9.79

95.4

15.1

317

32

60

3.13

5.87

Y

N

   

129.14

NA

NA

NA

NA

40

NA

1

NA

3

NA

22

NA

NA

NA

NA

1746

69

F

T

2.99

28.5

9.8

2.89

95.3

14.9

168

41

45

1.18

1.3

N

Y

Cyclosporine

PR

40.3

NA

NA

96

NA

72

NA

0

NA

0

NA

31

NA

NA

NA

NA

1754

59

F

T

5.16

46.2

16.2

10.89

89.5

12.7

255

48.7

43.2

5.3

4.7

N

N

   

267.9

NA

NA

NA

NA

54

NA

14

NA

8

NA

57

NA

NA

NA

NA

1796

59

M

T

4.47

37.8

12.4

1.65

84.6

16.9

181

12

76

0.2

1.25

Y

N

   

31.25

NA

NA

NA

NA

52

NA

0

NA

1

NA

25

NA

NA

NA

NA

1798

47

M

T

4.84

43.9

15.5

4.75

90.7

13.1

132

35

54.7

1.66

2.6

N

N

   

88.4

NA

NA

NA

NA

58

NA

0

NA

20

NA

34

NA

NA

NA

NA

1822

75

F

GD

3.27

23.7

7.3

14.2

72.5

20.9

103

NA

NA

0

0

NA

Y

Cytoxan

NE

 

73

NA

50

1

NA

1

NA

50

NA

1

NA

NA

NA

NA

NA

1844

61

F

T

3.83

38.1

13.3

7.5

99.5

12.2

229

26.7

65.3

2

4.9

N

N

     

NA

NA

94

65

NA

NA

NA

NA

NA

50

NA

NA

NA

NA

NA

1849

27

F

T

4.89

42.7

14.7

3.6

87.3

13.2

110

46

45

1.66

1.62

N

N

   

14.58

NA

NA

NA

NA

29

NA

0

NA

1

NA

9

NA

NA

NA

NA

1878

39

F

T

4.62

42.3

14.1

3.94

91.6

13.8

223

25.9

59.6

1.02

2.35

N

N

   

49.35

NA

NA

NA

NA

41

NA

0

NA

18

NA

21

NA

NA

NA

NA

1888

66

F

GD

4.53

34.5

11

3.11

76.2

16.4

109

0.4

80.4

0.01

2.5

Y

N

   

125

NA

58

NA

NA

68

NA

0

NA

0

NA

50

NA

NA

NA

NA

1895

70

F

T

4

35.7

12.4

9.2

89.3

13

252

55

36

5.06

3.31

N

N

   

99.3

NA

NA

NA

31

NA

NA

4

NA

18

NA

30

NA

NA

NA

NA

1906

55

M

T

4.4

40

14.1

3.93

90.9

13.8

158

19.3

67.2

0.76

2.64

N

N

   

116.16

NA

NA

NA

NA

53

NA

0

NA

0

NA

44

NA

NA

NA

NA

1918

50

F

T

2.46

26.5

8.8

14.79

107.7

17.2

184

NA

NA

0.42

13.89

N

N

   

958.41

NA

NA

NA

NA

96

NA

0

NA

69

NA

69

NA

NA

NA

NA

1919

54

M

T

3.98

35.3

11.9

6.06

88.7

13.7

249

51.3

35.3

3.11

2.14

N

N

   

68.48

NA

NA

NA

NA

45

NA

0

NA

15

NA

32

NA

NA

NA

NA

1942

29

F

T

5.02

43

14.4

3

85.7

13.2

319

34

60

1.02

1.8

N

N

   

34.2

NA

NA

NA

NA

43

NA

0

NA

14

NA

19

NA

NA

NA

NA

1945

64

F

T

2.85

30.7

10.5

5.6

107.7

NA

216

14

82

0.78

4.59

N

N

     

NA

NA

NA

NA

65

NA

NA

NA

NA

NA

NA

NA

NA

NA

NA

1948

79

M

T

3.36

30.2

9.1

4.95

89.9

16.3

243

54

30.1

2.67

1.49

N

N

   

83.44

NA

NA

NA

NA

31

NA

1

NA

34

NA

56

NA

NA

NA

NA

1955

71

F

T

4.82

42.9

14.1

8.92

89

14.9

37

30.8

53.5

2.75

4.77

N

N

   

381.6

NA

NA

NA

NA

72

NA

0

NA

6

NA

80

NA

NA

NA

NA

1960

62

M

GD

2.21

26.8

8.6

9.99

121.3

16.1

143

12.9

81.1

1.29

8.1

N

N

   

753.3

NA

66

NA

NA

55

NA

93

NA

0

NA

10

NA

NA

NA

NA

1970

79

F

T

2.29

25

8.2

6.76

109.2

NA

255

NA

NA

1.7

0

N

N

     

NA

NA

NA

NA

85

NA

NA

NA

NA

NA

NA

NA

NA

NA

NA

1973

59

M

T

3.03

32.9

10.7

13.67

108.6

16

248

6.6

88.7

0.9

12.13

N

N

     

NA

NA

50

50

NA

30

NA

NA

NA

30

NA

NA

NA

NA

NA

1974

33

M

T

2.4

26

8.6

2.8

108.3

19.9

214

8

83

0.22

2.32

NA

N

     

NA

NA

50

50

NA

1

NA

1

NA

50

NA

NA

NA

NA

NA

1985

57

M

T

4.18

38

12.5

4.7

90.9

13.8

233

15

66

0.71

3.1

N

N

   

77.5

NA

NA

NA

NA

47

NA

0

NA

4

NA

25

NA

NA

NA

NA

1999

65

M

T

4.6

39.6

13.9

12.43

86.1

12.7

375

22.9

65

2.85

8.08

N

N

     

NA

NA

NA

76

NA

2

NA

51

NA

82

NA

NA

NA

NA

NA

2009

64

F

T

4.79

40

13

8.16

83.5

14.4

265

38.9

48.3

3.17

3.94

N

N

   

149.72

NA

NA

NA

NA

74

NA

0

NA

44

NA

38

NA

NA

NA

NA

2018

37

F

T

3.66

35.8

12.2

10.5

97.8

15.3

403

23.5

72.4

2.47

7.6

NA

N

     

NA

NA

50

50

NA

65

NA

1

NA

50

NA

NA

NA

NA

NA

2020

36

M

T

4.47

40.3

13.2

3.36

90.2

14.7

80

3

29

0.1

0.97

N

N

   

33.756

NA

NA

NA

NA

10.5

NA

13.3

NA

2.9

NA

34.8

NA

NA

NA

NA

2022

66

M

T

4.39

39.9

13.5

3.72

90.9

14.3

152

58.9

30.9

2.19

1.15

N

Y

MTX

CR

42.55

NA

NA

NA

NA

48

NA

0

NA

4

NA

37

NA

NA

NA

NA

2024

63

F

T

NA

NA

NA

NA

NA

NA

NA

NA

NA

NA

NA

NA

NA

     

NA

NA

NA

54

NA

33

NA

9

NA

58

NA

NA

NA

NA

NA

2029

68

M

T

3.03

32.9

10.9

7.11

108.6

14.5

186

8.2

79.1

0.58

5.62

N

N

   

258.52

NA

NA

NA

NA

82

NA

0

NA

0

NA

46

NA

NA

NA

NA

2037

44

F

T

3.72

34.5

12.4

5.2

92.7

13.5

248

19

66

0.99

3.43

N

N

   

41.16

NA

NA

NA

NA

56

NA

0

NA

2

NA

12

NA

NA

NA

NA

2042

74

M

T

5.14

44.4

15.3

6.59

86.4

13.9

45

27.2

53.6

1.79

3.53

NA

N

   

208.27

NA

NA

NA

NA

70

NA

59

NA

1

NA

12

NA

NA

NA

NA

2049

59

F

T

4.37

36.7

12

6

84

14.6

256

17.2

74.1

1.03

4.45

N

N

     

NA

NA

95

NA

46

30

NA

1

NA

30

NA

NA

NA

NA

NA

2050

49

F

T

4.51

39.4

13.8

4.28

87.4

13.2

196

5.4

85.3

0.23

3.65

N

N

   

255.5

NA

NA

NA

NA

79

NA

70

NA

0

NA

59

NA

NA

NA

NA

2051

70

F

T

2.49

27.6

9.4

7.97

110.8

14.2

305

26.8

68.7

2.14

5.48

N

N

   

416.48

NA

NA

NA

NA

84

NA

0

NA

0

NA

76

NA

NA

NA

NA

2056

39

F

T

4.19

36.1

11.8

2.97

86.2

15.6

179

24

52.2

0.71

1.55

Y

Y

MTX

CR

41.85

NA

NA

NA

NA

47

NA

24

NA

1

NA

27

NA

NA

NA

NA

2062

46

M

T

2.82

26.6

8.8

3.19

94.3

19.4

74

19

24.1

0.61

0.77

N

Y

Cyclosporine

NR

23.87

NA

NA

NA

NA

85

NA

0

NA

0

NA

31

NA

NA

NA

NA

2074

57

F

T

4.18

36.9

12.4

5.67

88.3

14.2

235

16.7

73.9

0.95

4.19

N

N

   

201.12

NA

NA

NA

NA

66

NA

0

NA

8

NA

48

NA

NA

NA

NA

2077

13

F

T

5.6

40

12.4

3.1

71.4

15.4

261

16

80

0.5

2.48

N

Y

MTX

NE

138.88

NA

NA

NA

NA

82

NA

0

NA

0

NA

56

NA

NA

NA

NA

2080

48

M

GD

5

41.8

14.3

3.43

83.6

12.8

145

36.5

46.9

1.25

1.61

N

N

   

20.93

NA

49

NA

NA

70

NA

3

NA

15

NA

13

NA

NA

NA

NA

2081

46

M

T

2.35

24.3

8

2.72

103.4

21

347

30.5

58.8

0.83

1.6

N

Y

Cyclosporine

NR

86.4

NA

NA

NA

NA

73

NA

1

NA

73

NA

54

NA

NA

NA

NA

2082

66

M

T

4.48

42.8

14.5

11.06

95.5

12.9

275

36.5

38.3

4.04

4.24

N

N

   

237.44

NA

NA

NA

NA

78

NA

0

NA

2

NA

56

NA

NA

NA

NA

2083

65

M

GD

4.63

42.5

15.2

2.99

91.8

13.3

134

61.2

22.7

1.83

0.68

NA

N

   

20.4

NA

38

NA

NA

44

NA

30

NA

54

NA

NA

NA

NA

NA

NA

2084

69

M

T

5.11

42.9

14.1

5.2

84

14

131

49.7

36.3

2.58

1.89

N

N

   

45.36

NA

NA

NA

41

NA

NA

NA

NA

NA

NA

24

NA

NA

NA

NA

2090

56

F

GD

4.07

38.4

12.4

34.4

94.3

16.6

103

1.8

98.2

0.62

33.78

Y

Y

MTX

PR

 

50

NA

50

3

NA

50

NA

1

NA

50

NA

NA

NA

NA

NA

2095

64

M

T

4.44

40.8

14.1

3.25

91.9

15.7

163

19.4

58.8

0.63

1.91

Y

N

   

95.5

NA

NA

NA

NA

56

NA

0

NA

1

NA

50

NA

NA

NA

NA

2098

41

F

T

4.28

39.5

13.5

8.28

92.3

12.3

314

49.5

43.1

4.1

3.57

N

N

   

217.77

NA

NA

NA

NA

71

NA

0

NA

62

NA

61

NA

NA

NA

NA

2103

52

F

T

4.51

40.9

13.9

4.63

90.7

13.4

208

29.7

59.8

1.38

2.77

N

N

   

132.96

NA

NA

NA

NA

68

NA

2

NA

2

NA

48

NA

NA

NA

NA

2105

56

F

T

4.43

41.3

13.7

2.67

93.2

12.5

162

40.4

50.9

1.08

1.36

N

N

   

43.52

NA

NA

NA

NA

50

NA

1

NA

3

NA

32

NA

NA

NA

NA

2107

66

F

T

4.1

40.5

13.8

4.3

98.8

14.1

183

15

64

0.65

2.75

N

N

     

NA

NA

74.2

NA

21.2

50

NA

NA

NA

50

NA

NA

NA

NA

NA

2108

51

M

T

4.08

42

14.1

5.22

102.9

14.3

223

60.2

28.5

3.14

1.49

N

Y

Cytoxan

NE

35.76

NA

NA

NA

NA

42

NA

24

NA

1

NA

17

NA

NA

NA

NA

2110

34

F

T

3.77

37.6

12.6

2.66

99.7

15.2

144

32.7

57.5

0.87

1.53

N

N

   

70.38

NA

NA

NA

NA

73

NA

0

NA

0

NA

46

NA

NA

NA

NA

2116

75

F

GD

2.03

25.1

7.9

6.48

123.6

17.6

322

67.1

25

4.35

1.62

N

N

   

77.76

NA

23

NA

NA

70

NA

1

NA

1

NA

48

NA

NA

NA

NA

2118

25

M

T

5.13

44.2

16

3.39

86.2

11.8

278

43.4

46.6

1.47

1.58

N

N

   

34.76

NA

NA

NA

NA

44

NA

0

NA

4

NA

22

NA

NA

NA

NA

2119

69

F

T

3.06

31.7

10.4

3.27

103.6

15.4

54

13.2

79.5

0.43

2.6

N

N

   

114.4

NA

NA

NA

NA

83

NA

0

NA

2

NA

44

NA

NA

NA

NA

2120

75

M

T

2.89

28.6

9.7

3.98

99

18.5

218

47.5

32.4

1.89

1.29

N

N

   

42.57

NA

NA

NA

NA

72

NA

0

NA

1

NA

33

NA

NA

NA

NA

2122

71

M

T

4.24

39

13.9

3.39

92

13.6

124

26.9

51.3

0.91

1.74

N

N

   

41.76

NA

NA

NA

NA

44

NA

1

NA

0

NA

24

NA

NA

NA

NA

2125

70

F

T

3.9

35.3

11.8

7.74

90.5

14

197

37.4

54.1

2.89

4.19

N

N

   

196.93

NA

NA

NA

NA

66

NA

0

NA

0

NA

47

NA

NA

NA

NA

2126

74

M

T

2.29

24.5

8

6.31

107

16.6

405

1.8

78.6

0.11

4.96

N

N

   

367.04

NA

NA

NA

NA

84

NA

74

NA

0

NA

71

NA

NA

NA

NA

2127

53

F

T

4.76

41.7

13.6

26.8

87.6

NA

181

4

95

1.07

25.46

NA

NA

     

NA

NA

NA

67

NA

89

NA

21

NA

55

NA

NA

NA

NA

NA

2135

67

F

T

4.48

39.5

13.2

5.8

88.2

14.1

167

19.5

4.2

1.13

0.25

N

Y

MTX

NE

18

NA

NA

NA

NA

81

NA

0

NA

28

NA

72

NA

NA

NA

NA

2139

60

F

T

4.44

41.3

14

3.79

93

15

173

25.3

63.6

0.96

2.41

N

Y

MTX

NE

154.24

NA

NA

NA

NA

71

NA

0

NA

1

NA

64

NA

NA

NA

NA

2143

50

M

T

3.4

33.7

11.6

2.95

99.1

15.5

188

31.1

53.6

0.92

1.58

N

N

   

39.5

NA

NA

NA

NA

54

NA

0

NA

4

NA

25

NA

NA

NA

NA

2144

66

M

T

2.72

28.8

9.8

11.56

105.9

16.5

219

9.5

85.6

1.1

9.9

N

N

   

277.2

NA

NA

NA

NA

96

NA

0

NA

0

NA

28

NA

NA

NA

NA

2145

65

M

T

4.62

40.3

13.9

6.98

87.2

14.7

117

26.9

64.9

1.88

4.53

N

N

   

185.73

NA

NA

NA

NA

71

NA

0

NA

0

NA

41

13

13

9

14

2146

67

F

T

4.63

42

14.5

7.09

90.7

14

265

52.8

37.1

3.74

2.63

N

N

   

123.61

NA

NA

NA

NA

26

NA

0

NA

49

NA

47

NA

NA

NA

NA

2147

57

F

T

3.99

36.5

13

4.2

91.5

14.6

225

0.1

0.8

0.4

3.3

N

Y

MTX

NR

 

NA

NA

NA

52

NA

NA

NA

3

NA

30

NA

NA

NA

NA

NA

2151

81

M

T

3.51

33.8

11.5

10.1

96.3

17.1

72.1

18

72.1

1.82

7.28

N

N

   

414.96

NA

NA

NA

NA

92

NA

0

NA

0

NA

57

NA

NA

NA

NA

2152

67

M

T

2.69

26.8

8.8

6.08

99.6

16.1

287

39.6

43.8

2.41

2.66

N

N

   

119.7

NA

NA

NA

NA

78

NA

0

NA

0

NA

45

NA

NA

NA

NA

2153

61

F

T

5

44.4

14.7

7.31

88.8

15

184

4.5

31.2

0.33

2.28

N

Y

Cytoxan

NE

132.24

NA

NA

NA

NA

67

NA

1

NA

40

NA

58

NA

NA

NA

NA

2157

77

M

GD

2.73

30.2

10.3

7.49

110.6

18.2

303

46.2

45

3.46

3.37

NA

Y

MTX

NE

181.98

NA

54

NA

NA

82

NA

0

NA

0

NA

54

NA

NA

NA

NA

2164

57

M

T

4.96

42.1

14.4

4.13

84.9

13.9

211

19.1

61

0.79

2.52

N

N

   

131.04

NA

NA

NA

NA

67

NA

0

NA

2

NA

52

NA

NA

NA

NA

2165

51

F

T

4.27

40.7

13.2

3.75

95.3

16.5

311

57.4

26.1

2.15

0.98

N

Y

MTX

CR

27.44

NA

NA

NA

NA

51

NA

0

NA

10

NA

28

NA

NA

NA

NA

2169

65

M

T

4.71

42.4

14.5

6.11

90

12.7

173

43

43.9

2.63

2.68

N

N

   

134

NA

NA

NA

NA

59

NA

0

NA

40

NA

50

NA

NA

NA

NA

2173

55

F

T

3.33

34.9

12

2.9

104.8

15.4

294

25.5

62.1

0.74

1.8

N

N

   

75.6

NA

NA

NA

NA

78

NA

0

NA

0

NA

42

NA

NA

NA

NA

2174

71

F

T

4.23

38.5

13.1

5.37

91

12.2

219

67

24

3.6

1.29

N

N

   

24.51

NA

NA

NA

NA

41

NA

17

NA

1

NA

19

NA

NA

NA

NA

2180

53

F

T

4.08

36.6

13

6.45

89.7

17.1

93

24.8

69.5

1.6

4.48

N

N

   

120.96

NA

NA

NA

NA

93

NA

0

NA

3

NA

27

NA

NA

NA

NA

2183

53

M

T

4.58

42.6

14.1

6.99

93

13

214

46.7

3.3

3.26

0.23

N

N

   

7.82

NA

NA

NA

NA

44

NA

0

NA

3

NA

34

NA

NA

NA

NA

2186

56

F

GD

4.18

37.7

12

2.22

90.2

14

124

27.9

57.2

0.62

1.27

N

N

   

39.37

NA

25

NA

NA

48

NA

0

NA

0

NA

31

NA

NA

NA

NA

2188

56

M

T

4.89

42

13.8

8.29

85.9

14.1

223

5

74

0.41

6.13

N

N

   

337.15

NA

NA

NA

NA

81

NA

0

NA

0

NA

55

NA

NA

NA

NA

2190

44

F

T

2.87

28.5

9.3

2.67

99.3

15.6

152

29.1

50.6

0.78

1.35

N

N

   

36.45

NA

NA

NA

NA

54

NA

0

NA

0

NA

27

NA

NA

NA

NA

2191

52

F

T

3.84

35

11.3

2.7

91.1

15.2

156

1.5

78.9

0.04

2.13

N

Y

MTX

NE

29.82

NA

NA

NA

NA

68

NA

0

NA

0

NA

14

NA

NA

NA

NA

2194

64

F

T

4.04

40.4

13.1

6.27

100

12.7

180

43.3

48.6

2.71

3.05

N

N

   

91.5

NA

NA

NA

NA

52

NA

0

NA

2

NA

30

NA

NA

NA

NA

2200

56

M

T

3.87

37

13

3.09

95.6

NA

73

7.5

82.8

0.23

2.56

N

N

     

NA

NA

NA

NA

96

50

NA

NA

NA

30

NA

NA

NA

NA

NA

2202

38

M

T

5

43.3

14.7

12.75

86.6

13.9

122

27.4

61.9

3.49

7.89

N

N

   

552.3

NA

NA

NA

NA

80

NA

0

NA

0

NA

70

9

0

5

7

2204

64

F

T

3.88

38.3

13.5

10.35

98.7

14.8

338

50.1

39.8

5.19

4.12

Y

N

   

140.08

NA

NA

NA

NA

44

NA

0

NA

20

NA

34

NA

NA

NA

NA

2205

63

F

T

3

26

8.6

4.18

86.7

16.7

59

28.8

51.4

1.2

2.15

N

N

   

131.15

NA

NA

NA

NA

79

NA

0

NA

1

NA

61

NA

NA

NA

NA

2207

66

M

T

4.54

43.4

14.6

7.51

95.6

14.8

134

NA

NA

0

0

Y

N

   

0

NA

NA

NA

NA

57

NA

0

NA

1

NA

71

NA

NA

NA

NA

2208

48

M

GD

2.63

23.7

8

3.18

90.1

23.1

303

42.2

48.4

1.34

1.54

N

N

   

55.44

NA

52

NA

NA

21

NA

1

NA

1

NA

36

NA

NA

NA

NA

2214

65

F

T

5.07

42.7

14.5

3.2

84.2

14.8

168

30.6

53.7

0.98

1.72

N

N

     

NA

NA

91.4

NA

45.4

NA

NA

NA

NA

NA

NA

NA

NA

NA

NA

2217

63

M

T

5.16

45.7

14.5

4.53

88.6

15.3

130

34.2

55.4

1.55

2.51

N

N

   

122.99

NA

NA

NA

NA

58

NA

3

NA

9

NA

49

NA

NA

NA

NA

2225

54

F

T

5.02

40.2

13.9

7.7

80.1

14.1

241

13.3

64.6

1.02

4.97

N

N

   

258.44

NA

NA

NA

NA

81

NA

0

NA

0

NA

52

NA

NA

NA

NA

2226

63

M

T

4.07

37.1

12.4

2.2

91.2

15.5

41

7.7

84.5

0.17

1.86

N

N

   

89.28

NA

NA

NA

NA

70

NA

0

NA

2

NA

48

NA

NA

NA

NA

2228

60

F

T

5.34

43.7

14

12.99

81.8

16.5

136

8.7

80

1.13

10.39

N

N

   

862.37

NA

NA

NA

NA

78

NA

0

NA

0

NA

83

NA

NA

NA

NA

2247

43

F

GD

4.56

39.1

13.3

10.74

85.7

14.7

47

22.3

63.4

2.4

6.81

Y

N

   

313.26

NA

43

NA

NA

51

NA

0

NA

0

NA

46

NA

NA

NA

NA

2249

63

M

T

4.76

41.3

13.3

6.24

86.8

16.5

124

23.1

56.1

1.44

3.5

Y

N

   

175

NA

NA

NA

NA

66

NA

0

NA

2

NA

50

NA

NA

NA

NA

2251

71

M

T

2.83

24.5

8.1

7.09

86.6

15.7

135

10.5

71.9

0.74

5.1

N

N

   

331.5

NA

NA

NA

NA

94

NA

0

NA

0

NA

65

NA

NA

NA

NA

Supplemental Table 6.

LGL_Type: LGL subtype diagnosed in patient
RBC to ALC column: Complete Blood Count (CBC) parameters of patient
Rheumatoid Arthritis: Presence of concurrent Rheumatoid Arthritis
Treatment_at_sequencing: Was the patient on LGL treatment (Methotrexate, Cyclophosphamide, Cyclophosphamide) at time of sample acquisition for sequencing?
Treatment: Type of treatment received by patient (MTX = Methotrexate).
Treatment Response: Response to treatment patient received at time of sequencing.
  Complete response (CR) was defined as attainment of normal CBC (ANC > 1500/mm3; lymphocyte count < 4,000/mm3; hemoglobin > 11g/dl; platelet count > 100,000/mm3). In addition, LGL counts as determined by repeat flow cytometry needed to be in the normal range.
  Partial response (PR) was defined as improvement in hematologic parameters in the absence of CR: 1) ANC > 500, as long as this represented 50% increase (treatment category a); 2) improvement in ANC > 50% over baseline (treatment category b); 3) increase in hemoglobin by > 1g/dl for at least four months duration (treatment category c); and 4) decrease in monthly transfusion requirements of > 50% for at least four months duration (treatment category d). 
  No response (NR) was defined as lack of CR/PR. 
 Progressive disease (PD) was defined as worsening of hematologic parameters in patients previously achieving PR/CR. 
  Non-evaluable (NE): Lack of data to assess response, or patients who were treated for non-LGL.
LGL absolute count: Absolute number of LGL cells in (k/µL) calculated based on ALC counts and CD3+ CD16+ or CD3+ CD57+, which ever is higher.
TCRgdpos to CD94: Flow cytometry values of patient peripheral blood sample
NA values: Not available

CME / ABIM MOC

Genomic Landscape of TCRαβ and TCRγδ T-Large Granular Lymphocyte Leukemia

  • Authors: HeeJin Cheon, BSc; Jeffrey C. Xing, PhD; Katharine B. Moosic, BS; Johnson Ung, BS; Vivian W. Chan, MD; David Sukwon Chung, BS; Mariella F. Toro, BA; Omar Elghawy, BS; John S. Wang, BS; Cait E. Hamele, BS; Ross C. Hardison, PhD; Thomas L. Olson, PhD; Su-Fern Tan, PhD; David J. Feith, PhD; Aakrosh Ratan, PhD; Thomas P. Loughran Jr, MD
  • CME / ABIM MOC Released: 5/19/2022
  • Valid for credit through: 5/19/2023
Start Activity

  • Credits Available

    Physicians - maximum of 1.00 AMA PRA Category 1 Credit(s)™

    ABIM Diplomates - maximum of 1.00 ABIM MOC points

    You Are Eligible For

    • Letter of Completion
    • ABIM MOC points

Target Audience and Goal Statement

This activity is intended for hematologists, oncologists, geneticists, and other clinicians caring for patients with large granular lymphocyte (LGL) leukemia.

The goal of this activity is for the learner to be better able to describe the landscape of nonsynonymous somatic variants in LGL leukemia exomes, potential differences of these mutational profiles across LGL leukemia subtypes, and potential associations of mutational groups with clinical features; shared and unique molecular characteristics of T and GD LGL leukemia subtypes based on putative driver genes; and the transcriptomic and somatic mutational landscape of STAT3 mutations compared with wild type to identify their distinct molecular signatures and STAT3-mutation--specific clinical associations, according to the most extensive paired exome and transcriptome study of LGL leukemia to date (N=105: 93 T-LGL and 12 GD-LGL subtypes).

Upon completion of this activity, participants will:

  • Describe nonsynonymous somatic variants in large granular lymphocyte (LGL) leukemia exomes, potential differences of these mutational profiles across LGL leukemia subtypes, and potential associations of mutational groups with clinical features, according to a paired exome and transcriptome study of LGL leukemia
  • Determine shared and unique molecular characteristics of LGL leukemia subtypes (T-LGL, where cells express ab T-cell receptor [TCR], and GD-LGL, where cells express TCRγδ) based on putative driver genes; and the transcriptomic and somatic mutational landscape of STAT3-mutated patients compared with STAT3 wild type to identify their distinct molecular signatures and STAT3-mutation–specific clinical associations, according to a paired exome and transcriptome study of LGL leukemia
  • Identify clinical implications of mutations and clinical features associated with LGL leukemia, according to a paired exome and transcriptome study of LGL leukemia


Disclosures

Medscape, LLC requires every individual in a position to control educational content to disclose all financial relationships with ineligible companies that have occurred within the past 24 months. Ineligible companies are organizations whose primary business is producing, marketing, selling, re-selling, or distributing healthcare products used by or on patients.

All relevant financial relationships for anyone with the ability to control the content of this educational activity are listed below and have been mitigated according to Medscape policies. Others involved in the planning of this activity have no relevant financial relationships.


Faculty

  • HeeJin Cheon, BSc

    Department of Biochemistry and Molecular Genetics
    University of Virginia School of Medicine
    University of Virginia Cancer Center
    Department of Medicine
    Division of Hematology/Oncology
    University of Virginia School of Medicine
    Charlottesville, Virginia

  • Jeffrey C. Xing, PhD

    University of Virginia Cancer Center
    Department of Medicine
    Division of Hematology/Oncology
    University of Virginia School of Medicine
    Charlottesville, Virginia

  • Katharine B. Moosic, BS

    University of Virginia Cancer Center
    Department of Medicine
    Division of Hematology/Oncology
    University of Virginia School of Medicine
    Charlottesville, Virginia

  • Johnson Ung, BS

    University of Virginia Cancer Center
    Department of Medicine
    Division of Hematology/Oncology
    University of Virginia School of Medicine
    Charlottesville, Virginia

  • Vivian W. Chan, MD

    University of Virginia Cancer Center
    Department of Medicine
    Division of Hematology/Oncology
    University of Virginia School of Medicine
    Charlottesville, Virginia

  • David Sukwon Chung, BS

    University of Virginia Cancer Center
    Department of Medicine
    Division of Hematology/Oncology
    University of Virginia School of Medicine
    Charlottesville, Virginia

  • Mariella F. Toro, BA

    University of Virginia Cancer Center
    Department of Medicine
    Division of Hematology/Oncology
    University of Virginia School of Medicine
    Charlottesville, Virginia

  • Omar Elghawy, BS

    University of Virginia Cancer Center
    Department of Medicine
    Division of Hematology/Oncology
    University of Virginia School of Medicine
    Charlottesville, Virginia

  • John S. Wang, BS

    University of Virginia Cancer Center
    Department of Medicine
    Division of Hematology/Oncology
    University of Virginia School of Medicine
    Charlottesville, Virginia

  • Cait E. Hamele, BS

    University of Virginia Cancer Center
    Department of Medicine
    Division of Hematology/Oncology
    University of Virginia School of Medicine
    Charlottesville, Virginia

  • Ross C. Hardison, PhD

    Department of Biochemistry and Molecular Biology
    Center for Computational Biology & Bioinformatics
    The Pennsylvania State University
    State College, Pennsylvania

  • Thomas L. Olson, PhD

    University of Virginia Cancer Center
    Department of Medicine
    Division of Hematology/Oncology
    University of Virginia School of Medicine
    Charlottesville, Virginia

  • Su-Fern Tan, PhD

    University of Virginia Cancer Center
    Department of Medicine
    Division of Hematology/Oncology
    University of Virginia School of Medicine
    Charlottesville, Virginia

  • David J. Feith, PhD

    University of Virginia Cancer Center
    Department of Medicine
    Division of Hematology/Oncology
    University of Virginia School of Medicine
    Charlottesville, Virginia

  • Aakrosh Ratan, PhD

    Center for Public Health Genomics
    University of Virginia
    Department of Public Health Sciences
    University of Virginia School of Medicine
    Charlottesville Virginia

  • Thomas P. Loughran Jr, MD

    University of Virginia Cancer Center
    Department of Medicine
    Division of Hematology/Oncology
    University of Virginia School of Medicine
    Charlottesville, Virginia

CME Author

  • Laurie Barclay, MD

    Freelance writer and reviewer
    Medscape, LLC

    Disclosures

    Disclosure: Laurie Barclay, MD, has disclosed the following relevant financial relationships:
    Stock, stock options, or bonds: AbbVie Inc. (former)

Editor

  • Freda K. Stevenson, PhD

    Associate Editor, Blood

    Disclosures

    Disclosure: Freda K. Stevenson, PhD, has disclosed no relevant financial relationships.

Compliance Reviewer

  • Leigh A. Schmidt, MSN, RN, CMSRN, CNE, CHCP